back Return to this vector's summary.
ID   YCF3       preliminary; circular DNA; SYN; 7100 BP.
XX
AC   ATCC77155;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector YCF3 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pBR322/TRP1 from pBR322 & yeast TRP1 gene
RC   YCF1 from YRp14 & yeast Y' sequence & oligo
RC   YCF2 from YRp14 & yeast CEN4 or pNN130 & oligo
RC   YCF3 from YCF1
RC   YCF4 from YCF2
RA   Vollrath D., Davis R.W., Connelly C., Hieter P.;
RT   "Physical mapping of large DNA by chromosome fragmentation";
RL   Proc. Natl. Acad. Sci. U.S.A. 85:6027-6031(1988).
XX
RN   [2]
RC   YCF3-CTG1 from YCF3 & CTF1 gene
RC   YCF4-CTG1 from YCF4 & CTF1 gene
RA   Gerring S.L., Connelly C., Hieter P.;
RT   "Positional mapping of genes by chromosome blotting and chromosome
RT   fragmentation";
RL   Meth. Enzymol. 194:57-77(1991).
XX
CC   Shuttle chromosome fragmentation vector. [1]
CC   Constructed by replacing the 346 bp HindIII/BamHI fragment from YRp14
CC   with a 1.5 kb HindIII/BglII fragment containing the telomere-adjacent
CC   sequence (Y') and a polylinker.  EcoRI and HindIII sites were removed.
CC   [1]
CC   The order of the major features in this plasmid is: Y' - MCS - SalI -
CC   URA3 - SUP11 - rep - pMB1 ori - bla. [1]
CC   The sequence to be mapped is cloned into the MCS of both YCF3
CC   (ATCC 77155) and YCF4 (ATCC 77156) (both orientations being produced).
CC   NotI is used to linearize the constructs, which are transformed
CC   independently into YPH49. [2]
CC   YCF3 is used to recover sequences proximal to the mapping sequence.[2]
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--7.1; HindIII--7.1; BamHI--7.1; HindIII/BglII--7.1. (ATCC staff)
CC   Medium is 1227 LB plus ampicillin.
CC   NM (YCF3)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)
CC   HO (Saccharomyces cerevisiae YPH49)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. pBR322 4361bp
FT                   2. yeast, ARS3/SUP11-1 gene
FT                   -> pBR322-sup11
FT                   1. YIp5 5541bp
FT                   2. pBR322-sup11, ARS3/SUP11-1 gene
FT                   -> YRp14 6000bp
FT                   1. YRp14 remove HindIII-BamHI 346bp, YIp5 33..379
FT                   \ 5600bp
FT                   2. yeast HindIII-BglII 1500bp, Y' sequence
FT                   -> YCF1 7100bp
FT                   1. YCF1 remove AatII-HindIII 104bp,
FT                   \ YIp5 102bp 5472..5541..33/7100bp
FT                   T4 DNA polymerase:T4 DNA polymerase
FT                   2. oligo 26bp gatctgcggccgcgaattcaagcttg
FT                   -> YCF3 7100bp [no EcoRI, no HindIII in pBR322 part]"
FT   misc_binding    0..0
FT                   /note="MCS BglII-NotI-EcoRI-HindIII-BamHI"
FT   misc_binding    0..0
FT                   /note="SIT unique EcoRI-HindIII-BamHI"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
FT   CDS             0..0
FT                   /note="ANT yeast SUP11 gene"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//