back Return to this vector's summary.
ID   YEPSEC1    preliminary; circular DNA; SYN; 8969 BP.
XX
AC   A01686; ATCC67024;
XX
DT   01-JUL-1993 (Rel. 7, Created)
DT   01-JUL-1995 (Rel. 12, Last updated, Version 1)
XX
DE   Saccharomyces/E.coli plasmid vector YEpsec1 - incomplete.
XX
KW   cloning vector.
XX
OS   Cloning vector
OC   Artificial sequences; Cloning vehicles.
XX
RN   [1]
RC   pEMBLyex2 from pJDB219 & G2
RC   YEpsec1 from pEMBLyex2 & oligo
RA   Baldari C., Murray J.A., Ghiara P., Cesareni G., Galeotti C.L.;
RT   "A novel leader peptide which allows efficient secretion of a
RT   fragment of human interleukin 1 beta in Saccharomyces cerevisiae";
RL   EMBO J. 6:229-234(1987).
XX
RN   [2]
RC   C1, C2 from pLG670-Z & CYC1 promoter
RC   G1, G2 from pLG670-Z & GAL10 promoter
RA   Guarente L.;
RT   "Yeast promoters and lacZ fusions designed to study expression of
RT   cloned genes in yeast";
RL   Meth. Enzymol. 101:181-191(1983).
XX
RN   [3]
RC   pLG669 from YEp24 & CYC1 promoter & lacZ gene & lacI gene
RC   pLG669-Z from YEp24 & CYC1 promoter & lacZ gene
RC   pLG670-Z from pLG669-Z
RA   Guarente L., Ptashne M.;
RT   "Fusion of Escherichia coli lacZ to the cytochrome c gene of
RT   Saccharomyces cerevisiae";
RL   Proc. Natl. Acad. Sci. U.S.A. 78:2199-2203(1981).
XX
CC   Restriction digests of the clone give the following sizes (kb):
CC   EcoRI--9.5; PstI--9.5; BamHI/SmaI--8.9, 0.6; BamHI--9.5. (ATCC staff)
CC   This encodes amino acids 121-269. Because the secreted form includes
CC   amino acids 117-269,this clone encodes the complete active form less
CC   the first 4 N-terminal amino acids.
CC   The vector promoter (CYC1) and enhancer (UAS Gal) are from
CC   Saccharomyces cerevisiae; the leader sequence for secretion is from
CC   killer toxin of Kluyveromyces lactis; termination and poly(A) signals
CC   are from 2 micron plasmid.
CC   Protein secreted from transformed Saccharomyces cerevisiae is
CC   glycosylated (22 kDa) and shows biological activity (T cell
CC   activation).
CC   The YEpsec1 vector can be recovered by removing the 0.6 kb human IL1
CC   insert from the polylinker with BamHI.
CC   Medium is 1227 LB plus ampicillin.
CC   NM (YEpsec1)
CC   CM (no)
CC   NA (ds-DNA)
CC   TP (circular)
CC   ST ()
CC   TY (plasmid)
CC   SP (ATCC)
CC   HO (E.coli HB101)(Saccharomyces cerevisiae)(E.coli)
CC   CP ()
CC   FN (cloning)
CC   SE ()
CC   PA ()
CC   BR ()
CC   OF ()
CC   OR ()
XX
FH   Key             Location/Qualifiers
FH
FT   misc_feature    0..0
FT                   /note="1. YEp24 7769bp
FT                   2. yeast, CYC1 promoter
FT                   3. E. coli, lacZ gene
FT                   -> pLG669-Z 8000bp
FT                   1. pLG669-Z 8000bp
FT                   -> pLG670-Z 8000bp
FT                   1. pLG670-Z 8000bp
FT                   2. yeast 1400bp, GAL10 promoter
FT                   -> G2 9360bp
FT                   1. G2 PstI 9360bp, URA3 gene/YEp24 2482
FT                   Klenow
FT                   HindIII-BamHI 1735bp, URA3 gene/YEp24 2273..-?-..3785
FT                   2. pUC19 remove BamHI-HindIII 30bp 418..448, 2656bp
FT                   -> pY47 4391bp
FT                   1. pY47 HindIII-BamHI 1735bp, URA3 gene
FT                   \ YEp24 2273..-?-..3785
FT                   Klenow:Klenow
FT                   2. pEMBL18+ EcoRI 3960bp 229..229
FT                   fill in
FT                   -> pY55 5701bp
FT                   1. pMB9 5300bp
FT                   2. yeast 2 micron 3560bp, ori/LEU2 gene
FT                   -> pJDB219 8900bp
FT                   1. pJDB219 HindIII-HindIII 3560bp, leu2d/STB/2mic ori
FT                   2. pEMBL8+ HindIII 3939bp 259..259
FT                   -> pY43 7560bp
FT                   1. pY43 NdeI-StuI 3220bp, leu2-d/STB/2 micron ori
FT                   Klenow:Klenow
FT                   2. pY55 HindIII 5701bp
FT                   -> pEMBLyex2 8924bp
FT                   1. pEMBLyex2 remove SstI/SacI-KpnI 6bp,
FT                   \ pEMBL18+ 239..245/8918bp
FT                   2. oligo SacI-KpnI 78bp
FT                   \ gagctcatgaatatattttacatatttttgtttttgctgtcrttcgttca
FT                   \ rggtacccggggatcrctgaactgcacg,
FT                   \ K.lactis killer toxin leader
FT                   -> YEpsec1 8969bp"
FT   misc_binding    0..0
FT                   /note="MCS unique SmaI-BamHI-SalI-PstI-HindIII"
FT   rep_origin      0..0
FT                   /note="ORI E. coli pMB1 (ColE1 and pBR322)"
FT   CDS             0..0
FT                   /note="ANT E. coli beta-lactamase gene (bla)
FT                   ampicillin resistance gene (apr/amp)"
FT   rep_origin      0..0
FT                   /note="ORI yeast 2 micron"
FT   CDS             0..0
FT                   /note="ANT yeast LEU2 gene"
FT   promoter        0..0
FT                   /note="PRO yeast CYC1 gene"
FT   CDS             0..0
FT                   /note="ANT yeast URA3 gene"
XX
SQ   Sequence 1 BP; 0 A; 0 C; 0 G; 0 T; 1 other;
     n
//