pICL


Vector IG Sequence Link :
General : plasmid ds-DNA 8400 BP
Functions : (cloning)
Selection : ()
Copy Number :
Hosts : (E.coli)(E.coli HB101)(E.coli XL-1-Blue)(Saccharomyces cerevisiae)
Suppliers : (ATCC)
Misc.Comments : Deposited by: Gary G. Hermanson Restriction digests of the clone give the following sizes (kb): KpnI--6.3, 1.5, 0.6; SstI--8.4; BamHI--4.6, 3.8. (ATCC staff) TRP from pYAC4 is not really functional. (personal communication) Linearized vector is transformed into the YAC-containing yeast cells, followed by plating on medium lacking lysine and uracil (and containing 10 mg/L adenine to enhance the red color phenotype of recombinant clones). [1] YAC end fragment clones can be isolated from properly integrated DNA by digestion with one of the enzymes in the polylinker, religation by circularization, and transformation into Escherichia coli. [1] Vector designed to rescue the CEN end of an insert from a yeast artificial chromosome (YAC) constructed in a pYAC4-derived vector. Based on homologous recombination with the pYAC vector. [1] Positive colonies should have the rescue plasmid integrated into the YAC clone near the ScaI site in the beta-lactamase (ampR) gene. [1] DNA from positive colonies can be screened for proper integration of the vector using the following primers: 5'- GCGCTTAATGCGCCGCTACAGGGCG -3' and 5'- GCTCACCGGCTCCAGATTTATCAGC -3', complementary to the f1 ori and ampR sequences respectively. [1] Correctly integrated products will yield a 870 bp amplification product, that should be cleaved by PstI into two fragments: 705 bp and 165 bp. [1] The order of the major features of the rescue vector is: T7 promoter - SacI/polylinker/BamHI - LYS2 - XbaI - SphI - ScaI/ampR - pMB1 ori. [1] The order of the major features in a rcombinant YAC end fragment clone would be: T7 promoter - BamHI/polylinker/SacI - CEN end YAC insert - EcoRI - CEN - ARS - (TRP) - ScaI/ampR - pMB1 ori. [1] Medium is 1227 LB plus ampicillin.
Parents : ()
Siblings : ()
Descendents : ()


Return to Vector Homepage